Species Compatibility¶
Background¶
Accurate avian DNA sexing by CHD gene PCR depends on the conservation of the primer-binding regions across species. While the CHD gene is highly conserved across Aves, the intron region between primer binding sites varies in size. Most importantly, the degree of size difference between the CHD-W (female-specific) and CHD-Z (both sexes) intron determines whether gender can be reliably discriminated.
SENO has validated CHD-based PCR sexing for 250+ bird species across seven orders. This page documents validated groups, primer set selection guidance, and the process for adding new species to the validated list.
Validated Species List¶
SENO's CHD-based PCR sexing protocol has been validated for the following species groups:
| Group | Representative Species | Validation Status | Primer Set Typically Used |
|---|---|---|---|
| Psittaciformes (Parrots) | African Grey, Macaws, Amazons, Cockatoos, Conures, Lovebirds, Budgerigars, Parrotlets | ✓ Full validation | P2/P8; 2550F/2718R for small species |
| Columbiformes (Pigeons & Doves) | Racing Homer, Fantail, King, Tumbler, Fancy breeds, Ring-necked Dove | ✓ Full validation | P2/P8 (well resolved) |
| Passeriformes (Songbirds) | Canaries, Zebra Finch, Gouldian Finch, Society Finch, Bengalese Finch, Java Sparrow | ✓ Validated | P2/P8; 2550F/2718R for some |
| Galliformes (Game Birds) | Chickens, Quail, Pheasants, Turkeys | ✓ Validated | P2/P8 |
| Anseriformes (Waterfowl) | Ducks (various breeds), Geese, Swans | ✓ Validated | P2/P8; 2550F/2718R for some |
| Falconiformes (Raptors) | Falcons (Peregrine, Saker, Gyr), Hawks, Eagles (select species) | ○ Partial validation | P2/P8 (may require optimization) |
| Struthioniformes (Ratites) | Ostriches, Emus, Rheas | ○ Contact for feasibility | Species-specific primers may be needed |
Detailed Validation Status by Sub-Group¶
Psittaciformes (100+ validated species)¶
| Sub-Group | Validation Level | Notable Examples |
|---|---|---|
| Macaws (Ara, Anodorhynchus, Diopsittaca) | Full | All common and most rare macaw species |
| Amazons (Amazona spp.) | Full | 15+ Amazon species validated |
| Cockatoos (Cacatua, Eolophus, Nymphicus) | Full | White/black/pink cockatoos, cockatiels |
| African Greys (Psittacus) | Full | Both P. erithacus and P. timneh |
| Conures (Aratinga, Pyrrhura) | Full | Sun, Green-cheek, Jenday, Nanday, and more |
| Lovebirds (Agapornis) | Full | All 9 species |
| Budgerigars | Full | All colour mutations |
| Parrotlets (Forpus) | Full | Pacific, Green-rumped, and other species |
| Lorikeets (Trichoglossus, Lorius) | Full | Rainbow, Red-collared, and other lorikeet species |
Passeriformes (50+ validated species)¶
| Sub-Group | Validation Level | Notable Examples |
|---|---|---|
| Finches (Estrildidae) | Full | Zebra, Gouldian, Society, Spice, Java Sparrow |
| Canaries (Fringillidae) | Full | Red Factor, Yellow, White, Gloster, Border, Fife |
| Softbills | Partial | Some species validated; contact SENO for specific species |
Primer Set Selection¶
| Primer Pair | Forward (5'→3') | Reverse (5'→3') | Best For |
|---|---|---|---|
| P2/P8 | TCTGCATCGCTAAATCCTTT | CTCCCAAGGATGAGRAAYTG | Most species; standard pair |
| 2550F/2718R | GTTACTGATTCGTCTACGAGA | ATTGAAATGATCCAGTGCTTG | Species with co-migrating CHD bands |
When to Use Each Primer Set¶
| Scenario | Recommended Primer | Reason |
|---|---|---|
| Standard sexing of medium-to-large parrots | P2/P8 | Reliable size difference; validated across hundreds of samples |
| Small parrots (budgies, parrotlets, lovebirds) | P2/P8 + 2550F/2718R | Try P2/P8 first; use 2550F/2718R if bands co-migrate |
| Pigeons and doves | P2/P8 | Consistently resolved; ~25–30 bp difference |
| Songbirds and finches | P2/P8 | Generally well-resolved; 2550F/2718R backup |
| Waterfowl | P2/P8 | May need 2550F/2718R for some duck species |
| Unknown/unusual species | Both pairs | Run both in parallel for redundancy |
| Single band on P2/P8 | 2550F/2718R | Rule out co-migration before reporting as male |
Verification Process for New Species¶
When a species not yet in SENO's validated database is submitted, the following process applies:
- Contact SENO — Provide species name and sample source information
- Reference samples — If available, provide known-sex reference samples (minimum 1 male, 1 female) for method validation
- Primer cross-reactivity check — Both P2/P8 and 2550F/2718R are tested against the species genome
- Test batch validation — Minimum 5 samples processed with both primer sets
- Validation documentation — Fragment sizes recorded, gel images archived, reference samples stored at −80°C
| Step | Duration | Outcome |
|---|---|---|
| Initial contact & sample request | Same day | Quote for validation test |
| Sample receipt | 1–3 days (shipping) | Lab receives reference samples |
| Preliminary PCR (both primer sets) | 2–3 business days | Fragment size data |
| Repeat confirmation (minimum 5 replicates) | 2–3 business days | Reproducibility check |
| Final validation report | 1 business day | Species added to validated list |
Routine Validation (Free of Charge)¶
For bona fide submissions with reference samples, SENO performs initial validation at no charge. If the new species requires extensive primer optimization or resequencing, additional fees may apply.
Unvalidated Species¶
Species from orders that have not been validated at SENO may still work with standard primers due to the high conservation of the CHD gene across all birds. However, without validation data, the risk of co-migrating bands or amplification failure is higher. Clients submitting samples from unvalidated species should:
- Submit 2 samples minimum (in case of failure)
- Provide known-sex reference samples if possible
- Accept that results may be inconclusive in some cases
Cross-References¶
- Gender Testing Overview — CHD-based sexing principles
- PCR Sexing Method — Full protocol with primer sequences
- Parrot DNA Sexing — Psittacine-specific guidance
- Pigeon DNA Sexing — Columbiform-specific guidance
- Psittacines Species Guide
- Columbiformes Species Guide
- Passerines Species Guide
- CHD PCR Protocol — Quality-controlled protocol
Frequently Asked Questions¶
Q: What determines whether a species can be sexed by CHD-PCR? A: Three factors: (1) the primer-binding regions must be conserved (present and amplifiable), (2) the CHD-W and CHD-Z introns must differ sufficiently in size (typically ≥ 5 bp for capillary electrophoresis, ≥ 15 bp for gel), and (3) the DNA quality must be adequate from the sample type submitted.
Q: Can you sex a bird from a species you've never tested before? A: Often yes — the CHD primers are designed to bind highly conserved exon regions that span the intron. Because the CHD gene is present in all birds, the primers usually work. However, the specific fragment sizes cannot be predicted until tested, and in rare cases the W and Z fragments may be the same size.
Q: How many species has SENO validated? A: Over 250 bird species across Psittaciformes, Columbiformes, Passeriformes, Galliformes, Anseriformes, Falconiformes, and others. The database is continuously expanding.
Q: My species is in the "partial validation" group. What does this mean? A: Partial validation means the CHD-PCR has been shown to work for at least one species in that order, but not all species in the group have been individually tested. In most cases, closely related species within the same order will amplify successfully. Contact SENO for specific feasibility assessment.
Last updated: August 2026